Symbol table - PDFSEARCH.IO - Document Search Engine

Symbol table
Results: 249

#	Item
131	Candidate’s Guide to Accessible Elections The Candidates’ Guide to Accessible Elections Table of Contents Add to Reading List Source URL: www.adjtos.ca Language: English - Date: 2014-01-27 15:44:10 Disability Ergonomics Transportation planning Urban design Wheelchair lift Language interpretation Assistive technology Wheelchair International Symbol of Access Design Web accessibility Accessibility
132	1 Table A – Receipts By Source Categories Classification Receipt Symbol Add to Reading List Source URL: www.fiscal.treasury.gov Language: English - Date: 2014-12-17 14:36:07 Social Security Excise tax in the United States Reclamation fund Income tax in the United States Highway Trust Fund Consolidated Fund Land and Water Conservation Fund Railroad Retirement Board United States Taxation in the United States Government Dodd–Frank Wall Street Reform and Consumer Protection Act
133	Additional file 1 Table S1. Bovine oligonucleotide primers used for qPCR Gene Symbol Primers (5’ to 3’) Product[removed]size Efficiency1 Accession Number Nucleoside transporters SLC28A1 F: AGAAGTGAGGAAGGCGTGAA Add to Reading List Source URL: t-stor.teagasc.ie Language: English - Date: 2014-10-22 21:01:38
134	1 Table A – Receipts By Source Categories Classification Receipt Symbol Add to Reading List Source URL: www.fiscal.treasury.gov Language: English - Date: 2012-08-30 13:03:27 Excise tax in the United States Highway Trust Fund Consolidated Fund Railroad Retirement Board Unemployment Trust Fund Economy of the United States United States Government Social Security debate in the United States Taxation in the United States Social Security Income tax in the United States
135	1 Table A – Receipts By Source Categories Classification Receipt Symbol Add to Reading List Source URL: www.fiscal.treasury.gov Language: English - Date: 2012-08-30 13:34:49 Government Social Security Income tax in the United States Excise tax in the United States Consolidated Fund Highway Trust Fund Railroad Retirement Board Federal Insurance Contributions Act tax Unemployment Trust Fund Taxation in the United States Economy of the United States United States
136	1 Table A – Receipts By Source Categories Classification Receipt Symbol Add to Reading List Source URL: www.fiscal.treasury.gov Language: English - Date: 2012-11-06 10:52:07 Income tax in the United States Government Public economics Consolidated Fund Highway Trust Fund Railroad Retirement Board Unemployment Trust Fund Income tax Tax Taxation in the United States Social Security Excise tax in the United States
137	1 Table A – Receipts By Source Categories Classification Receipt Symbol Add to Reading List Source URL: www.fiscal.treasury.gov Language: English - Date: 2013-11-04 14:54:07 Income tax in the United States Excise tax in the United States Railroad Retirement Board Consolidated Fund Unemployment Trust Fund Highway Trust Fund Unemployment benefits Tax United States Taxation in the United States Government Social Security
138	1 Table A – Receipts By Source Categories Classification Receipt Symbol Add to Reading List Source URL: www.fiscal.treasury.gov Language: English - Date: 2012-08-07 15:05:57 Public economics Excise tax in the United States Social Security Income tax in the United States Consolidated Fund Highway Trust Fund Railroad Retirement Board Income tax Unemployment Trust Fund Taxation in the United States Economy of the United States Government
139	IAU Division I Working Group “Nomenclature for Fundamental Astronomy'' (NFA) LISTS OF ABBREVIATIONS, ACRONYMS, AND SYMBOLS Table 1: Abbreviations and Acronyms − Listed in Alphabetical Order Abbreviation Symbol Add to Reading List Source URL: syrte.obspm.fr Language: English - Date: 2007-11-28 12:08:16 Astrometry Angle Precession Celestial mechanics Equinox Right ascension International Celestial Reference System Sidereal time Ecliptic Astrology Celestial coordinate system Measurement
140	Present Weather (METAR text-to-symbol matching) Matching of METAR present weather text to symbol in table below is not necessarily endorsed by the National Weather Service or the World Meteorological Organization. Blue Add to Reading List Source URL: bcaws.aviationweather.gov Language: English - Date: 2012-01-04 17:28:00 METAR DZ

UPDATE